Register
What is the mRNA transcript if the complementary DNA is TCTGAG?
223k views
2 votes
What is the mRNA transcript if the complementary DNA is TCTGAG?

User Dmitry Maksakov
by
8.3k points

1 Answer

6 votes

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Step-by-step explanation:

User Vidyanand
by
9.0k points
← Prev Question Next Question →

Related questions

User AdamZ
asked Mar 4, 2018 69.4k views
What is the mrna if the complementary dna is tctgag?
AdamZ asked Mar 4, 2018
by AdamZ
8.7k points
1 answer
1 vote
69.4k views
User Brooklyn
asked Mar 4, 2022 56.1k views
What is the mRNA if the complimentary DNA is TCTGAG.​
Brooklyn asked Mar 4, 2022
by Brooklyn
7.9k points
1 answer
1 vote
56.1k views
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.5m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
What are three important types of forces
Two methods of active transport
What is the phenotype of a heterozygous person using T for tall and t for short
Link Copied!