223k views
2 votes
What is the mRNA transcript if the complementary DNA is TCTGAG?

1 Answer

6 votes

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Step-by-step explanation:

User Vidyanand
by
8.9k points