Question

10. In the following RNA molecules, indicate: The type of mutation that occurred: Substitution, insertion or deletion The consequence of the mutation: silent, missense, nonsense, or frameshift. ORIGINAL: 5' AUGUUUCCGAGCUGCCCCGAAUGCUGC 3' A. 5' AUGUUUCCGAGCUACCCCGAAUGCUGC 3' B. 5' AUGUUUCCGAGCUCCCCGAAUGCUGC 3' C. 5'AUGUUUCCGAGCUGACCCGAAUGCUGC3' D. 5' AUGUUUCCGAGCUGGCCCCGAAUGCUGC 3'

Answer 1

The various RNA sequences represent different types of mutations: substitution, deletion, and insertion, which result in different consequences: missense, nonsense, and frameshift mutations. Each occurs due to changes in the original RNA sequence.

Step-by-step explanation:

To answer your question, you need to compare the original sequence of the RNA to the individual variants:

• A. This represents a substitution mutation because there's a swap from 'G' in the original to 'A' in the variant (7th position). This will result in a missense mutation as it leads to the swapping of one amino acid for another in the synthesized protein.
• B. This is a deletion mutation since 'G' is missing when compared to the original at the 7th position. Such mutation is a frameshift because it changes the reading frame of the code.
• C. This is a substitution mutation again as 'G' is swapped for 'A' at the 8th position in the variant as compared to the original. This could potentially result in a missense mutation as it could change the amino acid coded for.
• D. Here we have an insertion mutation, where 'G' is added at the 8th position. This is a frameshift mutation as the reading frame is effectively shifted.

Learn more about RNA mutations