Thats a long one, but I got you!
A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).
The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:
1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.
2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.
3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.
4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.
To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.