Question

1. Using the line of nucleic bases provided complete the complimentary DNA base pair strand?

TATCGAGCCGTATGACGATGAACGAATTCCTAA
2. How many base pairings did you make?
3. Using the line of DNA nucleic bases provided complete the copy as messenger RNA (mRNA) to leave the nucleus and go to a ___________ site for the ordering of specific amino acids and production of _______________.

Answer 1

To complete the complementary DNA base pair strand, we need to match each nucleic base with its complementary base. The complementary bases are:

A -> T

T -> A

C -> G

G -> C

Using this information, we can complete the complementary DNA base pair strand:

ATAGCTCGGCATACTGCTACTTGCTTAAGGATT

We made a total of 34 base pairings.

To convert the DNA sequence into mRNA, we need to replace each DNA base with its corresponding mRNA base. The conversion rules are as follows:

A -> U

T -> A

C -> G

G -> C

Using these rules, the mRNA sequence would be:

UAUCGAGCCGUAUGACGAUGAACGAAUUCUAA

The mRNA leaves the nucleus and goes to a ribosome site for the ordering of specific amino acids and the production of proteins.