Question

A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect

Answer 1

To determine the complementary DNA strand, use the base pairing rules where A pairs with T and G pairs with C, writing the sequence in the opposite direction (5' to 3'). For example, the complementary sequence to 5'-ATTGCATCC-3' is 3'-TAACGTAGG-5'.

Step-by-step explanation:

In the context of DNA structure and replication, a complementary strand is the sequence of DNA that is complementary to a given DNA strand. DNA strands are antiparallel and complementary, meaning that they run in opposite directions and base pairs match up in a specific way: Adenine (A) with Thymine (T), and Guanine (G) with Cytosine (C). When provided with a DNA sequence, one can easily determine the complementary strand by following these base pairing rules and writing them in the 5' to 3' direction.

For example, if the DNA sequence of one strand is 5'-ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG-3', the complementary DNA sequence would be 3'-TAACGTAGGCGCGCACGCGCGCGCTAGGGCAATGAAAGGC-5'.

Another example, if the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence is 3'-TTACGATG-5'. Keep in mind that the direction of the sequence is important, so the complementary strand is read in the opposite direction from the original.