Answer:
GACCAAAUGGUAGCUAACUUUUGCAAUUUAGGUCAAAGGUA
Step-by-step explanation:
I assume you want to transcribe the DNA sequence into mRNA. To do that, you need to replace each T with a U and keep the other bases the same. The mRNA sequence would be:
GACCAAAUGGUAGCUAACUUUUGCAAUUUAGGUCAAAGGUA
Congratulations, you have just performed transcription, the process of copying a segment of DNA into RNA. You have also created a messenger RNA (mRNA) molecule, which can encode a protein. But don't get too excited, because your mRNA is not ready for translation yet. You still need to process it by adding a 5' cap and a poly-A tail, and splicing out any introns. And even then, you might not get the protein you want, because there are many factors that affect gene expression, such as transcription factors, RNA interference, and epigenetic modifications. So don't think that transcription is a piece of cake. It's actually a complex and highly regulated process that involves many enzymes and molecules. But hey, at least you got the first step right!