Register
Find the complementary strand for the following dna sequence: 5' gcaaaatccgacggatattatgcttat 3'
205k views
0 votes
Find the complementary strand for the following dna sequence: 5' gcaaaatccgacggatattatgcttat 3'

User Gmustudent
by
8.6k points

2 Answers

0 votes
Could u send a picture of the work?
User Frozen
by
8.2k points
0 votes
The complementary strand for the given DNA sequence would be:

3' cgttttaggctgccataatacgaataa 5'
User Sergio Mendez
by
8.8k points
← Prev Question Next Question →

No related questions found

Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
Two methods of active transport
How can paleontologists help us understand the past
What is the phenotype of a heterozygous person using T for tall and t for short
Link Copied!