56.8k views
2 votes
A mutation occurred in the sequence (see below, a G-C base pair was added to the sequence.What type of mutation is this? Define the term.

User LexLythius
by
8.6k points

1 Answer

5 votes

a. The mutation shown in the image is an insertion mutation.

Insertion mutation is a genetic mutation that occurs when one or more nucleotides are added into a DNA sequence causing a shift in the genetic code. This type of mutation involves the addition of one or more nucleotide base pairs into the DNA sequence.

b. Certainly, here is the transcription and translation of the given DNA sequence into mRNA and the corresponding amino acid sequence:

Transcription of DNA to mRNA:

3' GAUUAAUCCCGUCUAUGUCUGCAAUAUGACGAUGAAUUCCGCGCUUCGUAAAGUAUUUACUCCGAAUAAGGUACGG 5'

mRNA Sequence:

5' CUAAAUAGGGCAGATACAGACGUUAUACTGCTACTTAAGGCGCGAAGCAUUUCAUAAAATGAGGCUUAUUCCAUGCC 3'

Amino Acid Sequence:

Asp - Lys - Ser - Arg - Leu - Cys - Leu - Gln - Tyr - Met - Thr - Met - Asn - Ser - Ala - Leu - Arg - Lys - Val - Phe - Thr - Pro - Lys - STOP - Val - Arg

N-terminus (start of the protein): Aspartic Acid (Asp)

C-terminus (end of the protein): Arginine (Arg)

In conclusion, the resulting protein begins with Aspartic Acid (Asp) and ends with Arginine (Arg).

A mutation occurred in the sequence (see below, a G-C base pair was added to the sequence-example-1
User CodingBeginner
by
8.1k points

No related questions found

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.