Question

DNA Overview

DNA is the carrier of genetic information that all living things are made of. We can use DNA to tell us useful information, such as finding to whom it belongs and their relatives. So, DNA profiling can take a look at DNA to identify to whom it belongs.

-DNA is a sequence of molecules called nucleotides, arranged into a particular shape (a double helix). Each nucleotide of DNA contains one of four different bases: adenine (A), cytosine (C), guanine (G), or thymine (T). Every human cell has billions of these nucleotides arranged in sequence (genome).
How can this be accomplished through? DNA is composed of genes (which all humans share), and "junk" DNA (sections of non-coding DNA in between the genes that are highly variable between individuals). By looking at these sections of "junk DNA" we can identify a person through a DNA sample or find relatives.

What exactly are we looking for in this junk DNA? Inside of these sections of the DNA, since there is a high variance of what’s in there, we can uniquely identify individuals based on what’s in there by looking at STRs (Short Tandem Repeats).

What are STRs and how can I use them to tell me what I want to know? STRs are Short Tandem Repeats, which are short sequences of DNA that repeat back-to-back in every person numerous times. AGAT and ACGT are examples of short DNA sequences, which we can use as STRs.

Let’s take a DNA sequence which looks like this: AGATAGATAGATACGTACGT

Here, you see that the STR "AGAT" is repeated three times followed by another STR "ACGT" repeated twice (this is just one example of many possibilities). The more STRs we use to analyze a DNA sequence the more refined our list will be to find out the information (such as who it belongs to) we desire. When looking at these STRs in a DNA sequence we want to look at the longest number of times that given STR is repeated as well to properly find the highest variance of the STR.

The FBI uses 20 different STRs when processing DNA for their Combined DNA Index System (CODIS) database.

-For simplicity, we will be using 2 to 4 STRs that are a few nucleotides long.

The goal of this assignment is to carry out a DNA profiling method called STR analysis, where we look at STRs to accomplish the goals of finding out who the DNA sequence belongs to as well as finding relatives (parents in our case) of the sequence.

DNA.java
This class has two instance variables:
-database holds the profiles of all people in the database.
-STRsOfInterest holds the STRs (Short Tandem Repeats) we are interested in looking for while DNA profiling.

Answer 1

The "DNA" class in Java facilitates STR analysis, utilizing a database of profiles and specified STRs to identify individuals and their relatives based on the repetition patterns of short DNA sequences.

The "DNA" class in Java is designed for the purpose of conducting STR analysis, a method within DNA profiling. This class features two crucial instance variables: "database," which stores the profiles of all individuals in the database, and "STRsOfInterest," which specifies the Short Tandem Repeats (STRs) being targeted during DNA profiling. The essence of this profiling method lies in examining specific sections of DNA, often referred to as "junk DNA," which are highly variable among individuals.

By focusing on Short Tandem Repeats (STRs) within these sections, such as sequences like AGAT and ACGT, the class aims to identify unique patterns of repetition. The more STRs analyzed, the finer the resolution in determining the identity of the DNA sequence's owner and identifying potential relatives, particularly in the case of parents.

The class adopts a simplified approach by using 2 to 4 STRs of varying nucleotide lengths. This methodology aligns with real-world applications, where institutions like the FBI utilize 20 different STRs for processing DNA in their Combined DNA Index System (CODIS) database. Ultimately, the "DNA" class serves as a tool for effective DNA profiling, contributing to the identification of individuals and their familial connections based on distinctive DNA sequence patterns.