Final answer:
The transition mutation in the DNA would result in a substitution of the amino acid serine (ser) with arginine (arg) in the encoded polypeptide, changing the polypeptide sequence to fmet-asn-gln-pro-ile-pro-arg.
Step-by-step explanation:
The question asks about a transition mutation in the DNA that encodes an mRNA strand and the resulting sequence of the polypeptide in the mutant organism. The original mRNA sequence provided is 5' AUGAAUCAGCCGAUUCCCGUA 3', which encodes the polypeptide fmet-asn-gln-pro-ile-pro-val. The underlined C in the question is part of the triplet codon AGC that codes for serine (ser). A transition mutation in the DNA would lead to a change in this mRNA codon. Transition mutations involve a purine changing to another purine or a pyrimidine changing to another pyrimidine. If the C (cytosine) in the DNA that corresponds to the underlined C in mRNA was replaced with a T (thymine), this would lead to the G (guanine) in the mRNA being replaced with an A (adenine), changing the codon from AGC to AGA. Codon AGA codes for the amino acid arginine (arg). Therefore, the polypeptide sequence after this transition mutation would be fmet-asn-gln-pro-ile-pro-arg.