Question

In order to amplify the ENTIRE sequence shown below, design a forward and reverse 4 bp primer in the orientation of 5' to 3' (do not worry about melting temperature/specificity/primer dimers, we understand that these primers would not work in a real PCR): ATGACGGCATCGACTGTAGTAGT

Answer 1

To amplify the sequence 'ATGACGGCATCGACTGTAGTAGT' using PCR, a forward primer 'ATGA' and a reverse primer 'ACTA' can be used, both in the 5' to 3' direction. The primers are chosen to complement the ends of the DNA sequence of interest.

Step-by-step explanation:

To design a forward and reverse 4 bp primer for PCR to amplify the entire sequence 'ATGACGGCATCGACTGTAGTAGT', we would need to complement the sequence at both ends. In the orientation of 5' to 3', a possible forward primer would be 'ATGA' and a reverse primer would be the reverse complement of the last 4 bp, which is 'ACTA' (the reverse complement of 'TACT').

These primers are designed to anneal to the respective ends of the template DNA strand during PCR amplification. The forward primer binds to the beginning and the reverse primer binds to the end of the template strand, allowing for the creation of new strands of DNA during the PCR cycles.

Each primer is designed so that it is in the 5' to 3' direction to accommodate the activity of the DNA polymerase enzyme, which synthesizes the new DNA strand in that same direction.