Question

If you wanted to make a double stranded break in the following sequence you would design a 20 base guide RNA sequence.

ACGTGATCGATCGTGATCGATCGCAGCTAGCACATCCATCGCATCGATCTGCATCGACGCTAGC

Write the 20 base RNA sequence 5' to 3'.

Answer 1

The 20 base RNA sequence 5' to 3' derived from the given DNA sequence would be 5'-UGACUAUCGAUCGUGAUCGAUCGCAGCUAGCACAUCCAUCGCAUCGAUCUGCACGACGCUAGC-3'.

Step-by-step explanation:

The 20 base RNA sequence 5' to 3' can be derived from the given DNA sequence by replacing each T with U. Therefore, the 20 base RNA sequence would be 5'-UGACUAUCGAUCGUGAUCGAUCGCAGCUAGCACAUCCAUCGCAUCGAUCUGCACGACGCUAGC-3'.