Question

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG.

a) Translate the mRNA sequence into a protein.
b) Identify the start and stop codons within the mRNA sequence.
c) Determine the number of amino acids encoded in the sequence.
d) Explain the significance of the mRNA sequence in protein synthesis.

Answer 1

The mRNA sequence CUAUGUGUCGUAACAGCCGAUGACCCG translates to the protein sequence Leu-Cys-Val-Cys-Thr-Gly-Asp-Pro.

Step-by-step explanation:

The mRNA sequence CUAUGUGUCGUAACAGCCGAUGACCCG translates to the protein sequence Leu-Cys-Val-Cys-Thr-Gly-Asp-Pro.

The start codon is AUG, which specifies the initiation of translation. The stop codons are UAA, UAG, and UGA, which signal the termination of protein synthesis.

The number of amino acids encoded in the sequence is six.

The mRNA sequence is significant in protein synthesis because it carries the genetic information from DNA to the ribosomes, where it is translated into a protein. Each codon in the mRNA sequence corresponds to a specific amino acid, allowing the protein to be synthesized with the correct sequence of amino acids.