The DNA sequence GTACGCGTATACCGACATTC transcribes to CAUGCGCAUAUGGCUGUAAG, and its translation yields the amino acid sequence HAHMGCU, where translation stops at the stop codon (UAA).
To determine the amino acids encoded by the DNA sequence GTACGCGTATACCGACATTC, we need to transcribe the DNA into RNA and then translate the RNA sequence into amino acids using the genetic code.
1. Transcription (DNA to RNA):
- GTACGCGTATACCGACATTC (DNA)
- CAUGCGCAUAUGGCUGUAAG (RNA)
2. Translation (RNA to Amino Acids):
- Using the genetic code, we can group the RNA sequence into codons (three nucleotides) and determine the corresponding amino acids.
- CAU: Histidine (H)
- GCG: Alanine (A)
- CAU: Histidine (H)
- AUG: Methionine (M)
- GGC: Glycine (G)
- UGU: Cysteine (C)
- UAA: Stop codon (terminates translation)
Therefore, the amino acid sequence encoded by the given DNA sequence is HAHMGCU. Note that translation stops at the stop codon (UAA), and the last codon (ACU) does not contribute to the final amino acid sequence.
The complete question is:
What are the amino acids of the DNA sequence given below:
GTACGCGTATACCGACATTC