Question

Your second favorite gene (SFG) from E. coli is very small. Using recombinant DNA technology you managed to clone the whole piece of DNA that contains all codons (including stop and start codons) for protein synthesis. Using recombinant DNA, you determined DNA sequence and following is the sequence you obtained from the automated sequencing machine.

5’ GTCGGTTAATATCAAGCTGATTCGGGAGGCATCCT 3’

How many amino acids in SFG protein?

Answer 1

The SFG protein coded by the given DNA sequence contains 12 amino acids.

To determine the number of amino acids encoded by the SFG (Second Favorite Gene) protein from the provided DNA sequence, one needs to translate the DNA sequence into its corresponding mRNA sequence and then use the genetic code to find the amino acid sequence. The given DNA sequence is "5’ GTCGGTTAATATCAAGCTGATTCGGGAGGCATCCT 3’."

First, transcribe the DNA into mRNA. Since DNA and RNA share complementary bases except for thymine (T) in DNA, which is replaced by uracil (U) in RNA, the mRNA sequence is:

"3’ CAGCCAATATAAGUUCUGAAUUCGACCCUACCGGA 5’."

Now, determine the codons (triplets of nucleotides) and their corresponding amino acids using the genetic code. The amino acid sequence encoded by the mRNA is:

GUC - Glycine (Gly)

GGU - Proline (Pro)

UAA - Stop codon

Counting the amino acids, we find that the SFG protein coded by the given DNA sequence consists of two amino acids, Glycine and Proline, before the termination with a stop codon. Therefore, the SFG protein contains a total of 2 amino acids.