The mRNA sequence AUGAAUGCCUGGUCAGGUUAA translates to the amino acid sequence Met-Asn-Ala-Trp-Ser-Gly, with the start codon AUG initiating the sequence and the stop codon UAA concluding protein synthesis.
To translate an mRNA sequence into its corresponding codons and amino acids, you can use the genetic code chart. Here's the translation for the given mRNA strand:
mRNA: AUGAAUGCCUGGUCAGGUUAA
1. AUG - Methionine (Start codon)
2. AAU - Asparagine
3. GCC - Alanine
4. UGG - Tryptophan
5. UCA - Serine
6. GGU - Glycine
7. UAA - Stop codon
Therefore, the amino acid sequence is: Methionine - Asparagine - Alanine - Tryptophan - Serine - Glycine.
The complete question is:
Translate this mRNA strand into their respective Codons using the chart below. write the correct amino acid sequence.
AUGAAUGCCUGGUCAGGUUAA