Question

GIve forward and reverse primers for this sequence:

5' atgaaagg atttattgat gatgcaaact actccgttgg 3'

Answer 1

The forward and reverse primers for the given sequence are 5' CTTCTTTAATCAACTACTG 3' and 5' CCAACGGAGTAGTTTGCATC 3', respectively.

Step-by-step explanation:

The forward and reverse primers for the given sequence are:

Forward primer: 5' CTTCTTTAATCAACTACTG 3'

Reverse primer: 5' CCAACGGAGTAGTTTGCATC 3'

These primer sequences are complementary and have opposite chain directions to accommodate Watson-Crick pairings. They are also written in the 5' to 3' direction.