75.8k views
2 votes
GIve forward and reverse primers for this sequence:

5' atgaaagg atttattgat gatgcaaact actccgttgg 3'

User Laquanda
by
8.8k points

1 Answer

3 votes

Final answer:

The forward and reverse primers for the given sequence are 5' CTTCTTTAATCAACTACTG 3' and 5' CCAACGGAGTAGTTTGCATC 3', respectively.

Step-by-step explanation:

The forward and reverse primers for the given sequence are:

Forward primer: 5' CTTCTTTAATCAACTACTG 3'

Reverse primer: 5' CCAACGGAGTAGTTTGCATC 3'

These primer sequences are complementary and have opposite chain directions to accommodate Watson-Crick pairings. They are also written in the 5' to 3' direction.

User PhilHarvey
by
8.2k points
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Categories