Question

What would be the sequence of an RNA produced by using the DNA sequence shown below as a template? 3′ TACCGTGCGTGACATTAAGCC 5′". Write the sequence from 5′ to 3′, left to right

Answer 1

The complementary RNA sequence for the DNA template 3' TACCGTGCGTGACATTAAGCC 5' is 5' AUGGCACGCACUGUAAUUCGG 3', following the rules of base pairing, and it's written in the 5' to 3' direction.

Step-by-step explanation:

The DNA sequence provided is 3' TACCGTGCGTGACATTAAGCC 5'. To determine the RNA sequence produced, we use the complementary base pairing rules, keeping in mind that RNA uses uracil (U) instead of thymine (T). The complementary RNA sequence for the given DNA template from 5' to 3' is thus 5' AUGGCACGCACUGUAAUUCGG 3'.

Step-by-step explanation:

• The DNA template has adenine (A) opposite to which is uracil (U) in RNA.
• Guanine (G) is complementary to cytosine (C) in both DNA and RNA.
• Thymine (T) in DNA is complemented by adenine (A) in RNA.
• Cytosine (C) is matched with guanine (G).

When reading off the RNA sequence, we always read from the 5' to 3' direction. Therefore, the sequence should be written left to right as determined by the original DNA template strand.