a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.