Register
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC
169k views
4 votes
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC

User Gerard Banasig
by
8.1k points

1 Answer

6 votes
There are seven codons in this sequence . A codon is made with every three letters .
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC-example-1
User ConnorWGarvey
by
9.4k points
← Prev Question Next Question →

Related questions

User Milo P
asked Nov 17, 2022 36.1k views
Please help write a rule to represent the secuence 3, -12, 48, ...
Milo P asked Nov 17, 2022
by Milo P
8.0k points
1 answer
0 votes
36.1k views
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
Two methods of active transport
Vesicles that contain a cells digestive enzymes are called ?
in rabbits, black fur is dominant over white fur. Show the cross of a heterozygous black male with a homozygous white female.
Link Copied!