Register
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC
169k views
4 votes
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC

User Gerard Banasig
by
7.5k points

1 Answer

6 votes
There are seven codons in this sequence . A codon is made with every three letters .
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC-example-1
User ConnorWGarvey
by
8.5k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

8.6m questions

11.2m answers

Other Questions

What are three important types of forces
Two methods of active transport
How can paleontologists help us understand the past
What is the phenotype of a heterozygous person using T for tall and t for short
Vesicles that contain a cells digestive enzymes are called ?
Link Copied!