Question

In a cell replicating the DNA fragment of Figure 7, the non-coding strand (II) is used as a template for the synthesis of the coding strand (I).5 AAAAAAATGGTGCACCTTACGCCAGAGGAG 3¹ (1) 3 TTTTTTTACCACGTGGAATGCGGTCTCCT C 5΄ (I)Figure 7In violation of the complementarity rule, the 10th nucleotide incorporated by DNA polymerase is T instead of G. After two consecutive cell divisions, four cells result. In how many of them will a change in the amino acid sequence occur during the translation of this particular gene?

Answer 1

The change in the aminoacid sequence will occur in the four cells resultant.