Register
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the above (Question 2) transcription.
193k views
2 votes
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the above (Question 2) transcription.

User Hyunbong Lee
by
7.6k points

1 Answer

4 votes
3’ tcgccctactcgcgtacaccgcgtattgac 5’ turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
User Ajmartin
by
8.4k points
← Prev Question Next Question →

Related questions

Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.5m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Two methods of active transport
How can paleontologists help us understand the past
What is the phenotype of a heterozygous person using T for tall and t for short
Vesicles that contain a cells digestive enzymes are called ?
Link Copied!