178k views
3 votes
Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?

User Richsage
by
7.6k points

1 Answer

3 votes

Answer: it will be higher

Step-by-step explanation:

It will be higher because RNA has a higher thermal stability than DNA

User Scorix
by
7.5k points
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Categories