Register
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
200k views
3 votes
What is the complementary DNA strand for the following sequence:
ATGGCTTGCCAAGGTCCGGAAACTTTG

User Jconlin
by
6.6k points

1 Answer

5 votes
TACCGAACGGTTCCAGGCCTTTCAAAG
User Michael Green
by
6.2k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

6.5m questions

8.7m answers

Other Questions

When weak acids react with strong bases, the H+ from the weak acid is transferred to the: metal of the strong base to form a metal hydride OH− from the strong base to form water and a salt salt that is
Some elements can have multiple molecular forms in the same physical state. these multiple forms are called a. isotopes. b. isotropes. c. allotropes. d. multi-tropes.
True or false: in the water cycle, water returns to Earth as condesation, usually in the form of rain or snow.
The original amount of a radioactive sample should be multiplied by which expression to calculate the amount of the sample that remains after n half-lives have passed? (1/2)xn (1/n)^2 (1/2)^n 1/(2n)
How many moles of ca(no32 are in 400 ml of a 0.80 m calcium nitrate solution?
Link Copied!