Register
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
207k views
4 votes
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

User Jero Toryaki
by
8.7k points

1 Answer

4 votes

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

User Jigfox
by
7.8k points
← Prev Question Next Question →

No related questions found

Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
What are three important types of forces
What is the phenotype of a heterozygous person using T for tall and t for short
Vesicles that contain a cells digestive enzymes are called ?
in rabbits, black fur is dominant over white fur. Show the cross of a heterozygous black male with a homozygous white female.
Link Copied!