Register
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?
25.7k views
0 votes
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

User Jkgeyti
by
8.1k points

1 Answer

4 votes
UACCGCUCCGCCGCUCGACAAUACC
User Voskart
by
8.4k points
← Prev Question Next Question →

No related questions found

Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Other Questions

Why aren't all minerals gemstones?
What are three important types of forces
Two methods of active transport
How can paleontologists help us understand the past
Vesicles that contain a cells digestive enzymes are called ?
Link Copied!