Register
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?
25.6k views
0 votes
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

User Jkgeyti
by
4.9k points

1 Answer

4 votes
UACCGCUCCGCCGCUCGACAAUACC
User Voskart
by
5.2k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.6m questions

7.3m answers

Other Questions

Which of these structures is primarily responsible for the enzymatic breakdown of a large molecules in the cell?
What are some common signs and symptoms of mental health disorders?
A state of joyful activity in which the subject performs an action effortlessly and skillfully is known as a(n) __________.
!! Earth Science!! Carbon dioxide is normally approximately 2% fraction of the air in the atmosphere. The reason carbon dioxide is considered a pollutant is because... a) Carbon dioxide levels are much
What information does the atomic mass of an element provide? Question 8 options: A the number of protons and neutrons in an atom B the difference between the number of protons and electrons C the number
Link Copied!