Register
Replication, Transcription, and Translation Chart Please answer DNA Replication: 1。Template Strand: Start with this nucleotide chain. TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC 2。Complementary DNA Strand:
126k views
5 votes
Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

User Guillaume Ponce
by
5.4k points

1 Answer

1 vote

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Step-by-step explanation:

User Pratik Roy
by
5.4k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.6m questions

7.3m answers

Other Questions

Which of these structures is primarily responsible for the enzymatic breakdown of a large molecules in the cell?
What are some common signs and symptoms of mental health disorders?
A state of joyful activity in which the subject performs an action effortlessly and skillfully is known as a(n) __________.
!! Earth Science!! Carbon dioxide is normally approximately 2% fraction of the air in the atmosphere. The reason carbon dioxide is considered a pollutant is because... a) Carbon dioxide levels are much
Which statement best describes the life cycle of plants such as ferns? a. Different plants have a different number of phases in their life cycle. b. Plants have a single life cycle and are entirely haploid.
Link Copied!