Register
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify
82.5k views
4 votes
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.

AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."

User Sathish Kumar K K
by
4.5k points

2 Answers

4 votes
I agree I think it is C
User JiangHongTiao
by
4.4k points
7 votes

Answer:

C.) Separate the list into three-letter

Step-by-step explanation:

User Jeremy Kie
by
5.0k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.1m questions

6.7m answers

Other Questions

An example of the interaction of the nervous and endocrine systems can be seen in our response to danger. The _______________ orders the adrenal glands to release the hormones epinephrine and norepinephrine,
When an individual stops breathing, brain cells die very quickly, but the cells in the heart are able to survive for longer. Which conclusion is best supported by these facts?
Greg has been given a small sample of metal. His teacher has assigned him to identify what type of metal he was given. Which of the following is a physical property that will help Greg to identify the
Pixels are often referred to using DPI, or dots per inch. True\False
Charles Darwins observation adventures of different species on the Galapagos islands have many similar physical characteristics supports the hypothesis hypothesis that these finches
Link Copied!