Register
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
156k views
3 votes
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls-example-1
User Elgayed
by
4.5k points

1 Answer

1 vote
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
User Tawheed
by
4.5k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.1m questions

6.7m answers

Other Questions

An example of the interaction of the nervous and endocrine systems can be seen in our response to danger. The _______________ orders the adrenal glands to release the hormones epinephrine and norepinephrine,
When an individual stops breathing, brain cells die very quickly, but the cells in the heart are able to survive for longer. Which conclusion is best supported by these facts?
Greg has been given a small sample of metal. His teacher has assigned him to identify what type of metal he was given. Which of the following is a physical property that will help Greg to identify the
Pixels are often referred to using DPI, or dots per inch. True\False
Charles Darwins observation adventures of different species on the Galapagos islands have many similar physical characteristics supports the hypothesis hypothesis that these finches
Link Copied!