Question

A DNA sequence encoding a five-amino acid polypeptide is given below:

...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …
...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA…

a. Locate the sequence encoding the five amino acids of the polypeptide and identify the template and coding strands of DNA.
b. Give the sequence and polarity of the mRNA encoding the polypeptide.
c. Give the polypeptide sequence and identify the N-terminus and C-terminus.
d. Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Delgarno sequence.
e. What is the function of the Shine-Delgarno sequence?

Answer 1

Step-by-step explanation:

The sequence recording the five amino acid is 5' CTA-ATC-AGA-CCG-TAC-CAT 3'

The template strand is the strand from which the mRNA is transcribed

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding stranger has the same sequence as the mRNA except the replacement of T with U in the mRNA

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. The shine delgarno region is GGAGGA

e. This region functions as the mRNA binding site to the small subunit of the ribosome in the process of translation.