218k views
1 vote
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

1 Answer

5 votes

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Step-by-step explanation:

User Zutty
by
7.7k points
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.