Answer:
substitution mutation
Step-by-step explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.