Pls, I need help with this! Biology Thank you :)

asked Jan 12, 2022 223k views

22 votes

5.2k points

Please log in or register to add a comment.

6 votes

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Step-by-step explanation:

Salar Rastari answered Jan 18, 2022

5.9k points

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

6.0m questions

7.9m answers