Register
Pls, I need help with this! Biology Thank you :)
223k views
22 votes
Pls, I need help with this! Biology Thank you :)

Pls, I need help with this! Biology Thank you :)-example-1
User Tom Van Zummeren
by
7.7k points

1 Answer

6 votes

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Step-by-step explanation:

User Salar Rastari
by
9.4k points
← Prev Question Next Question →

No related questions found

Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.5m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
Two methods of active transport
How can paleontologists help us understand the past
What is the phenotype of a heterozygous person using T for tall and t for short
Link Copied!