Register
Pls, I need help with this! Biology Thank you :)
223k views
22 votes
Pls, I need help with this! Biology Thank you :)

Pls, I need help with this! Biology Thank you :)-example-1
User Tom Van Zummeren
by
3.3k points

1 Answer

6 votes

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Step-by-step explanation:

User Salar Rastari
by
3.5k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

3.5m questions

4.5m answers

Other Questions

Gibberellic acid stimulates the cells of germinating grass seeds to produce mrna molecules that code for hydrolytic enzymes. In this case the role of gibberellic acid can best be described as that of
Name three ecosystem services provided by biodiversity.
As in most areas of biology, the study of mitosis and the cell cycle involves a lot of new terminology. Knowing what the different terms mean is essential to understanding and describing the processes
Climate change is a ___ environmental change
Which subsystems are most effected by this use of water
Link Copied!