Question

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

a) Translating the original and mutated mRNA, identifying changes in amino acid sequence.
b) Identifying the start codon and predicting frameshift consequences.
c) Describing the process of protein folding from mRNA sequences.
d) Explaining the role of insertion mutations in protein degradation pathways.

Answer 1

A normal mRNA sequence includes a start codon that signals the beginning of translation. An insertion mutation can cause a frameshift mutation, altering all subsequent amino acids, resulting in a potentially non-functional protein.

Step-by-step explanation:

Translation of the original mRNA: AUG-AAA-UAC-GGC-U

Translation of the mutated mRNA: AUG-AAA-UAC-GGC-UAA-GCA

The insertion mutation in the mRNA causes a frameshift, meaning that all of the codons after the mutation are read differently. This can have a dramatic effect on the amino acid sequence and, consequently, the protein product. Frameshift mutations can result in the insertion or deletion of amino acids, alteration of the reading frame, and even premature stop codons, leading to nonfunctional proteins.

A normal mRNA sequence is translated into a protein by reading nucleotides in groups of three, known as codons. Each codon specifies a particular amino acid. The original mRNA sequence 5' -UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3' contains the initiation codon AUG, which codes for methionine, signifying the start of translation. The insertion mutation in the sequence changes the mRNA to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC-3'. This mutation inserts an extra uracil (U) base after the second codon, leading to a frameshift mutation.

As a result, each following codon is read incorrectly, altering each amino acid that comes after the mutation and likely resulting in a non-functional protein. The insertion mutation affects the reading frame early in the sequence which is particularly troublesome since more of the protein will be altered, possibly leading to significant functional impacts or even the creation of a premature stop codon.