Question

DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is

transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Answer 1

Transcription is the process where the genetic code from DNA is transcribed into RNA, with uracil (U) replacing thymine (T). The transcribed RNA from the provided DNA sequence 'ATGCCTAAGCCGTGTCCGAT' is 'UACGGAUUCGGCACAGGCUA'.

Step-by-step explanation:

Transcription of DNA to RNA

DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are both nucleic acids involved in the process of protein synthesis. DNA contains the genetic blueprint within its sequence of nitrogen bases adenine (A), guanine (G), cytosine (C), and thymine (T), and is structured as a double helix. In contrast, RNA, which is typically single-stranded, uses adenine, guanine, cytosine, and uracil (U) instead of thymine. Transcription is the process whereby DNA is transcribed into RNA, enabling the genetic code to leave the nucleus and guide protein synthesis in the cytoplasm. During transcription, an enzyme called RNA polymerase constructs a strand of RNA by creating complementary pairs to the DNA template strand, with uracil pairing with adenine.

Given the DNA sequence 'ATGCCTAAGCCGTGTCCGAT', the transcribed RNA sequence would be 'UACGGAUUCGGCACAGGCUA'.

Answer 2

Transcription and translation are the processes by which cells read or express the genetic instructions encoded in their DNA. Because multiple identical RNA copies may be produced from the same gene, and each RNA molecule can drive the creation of many similar protein molecules, cells can swiftly create a vast amount of protein when needed. However, each gene may be transcribed and translated with varying degrees of effectiveness, allowing the cell to produce massive amounts of some proteins while producing minute amounts of others (Figure 6-3). Furthermore, as we will learn in the following chapter, a cell may adjust (or regulate) the expression of each of its genes based on the demands of the moment—most visibly by managing RNA synthesis.