Register
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.
106k views
5 votes
5’ATGCCCGGGTGTCGTAGTTGA3’

Complete the complementary sequence for the template strand.

User Gottox
by
8.9k points

1 Answer

2 votes

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'

User Ravuya
by
8.8k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.5m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
What are three important types of forces
Two methods of active transport
How can paleontologists help us understand the past
What is the phenotype of a heterozygous person using T for tall and t for short
Link Copied!