Register
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify
82.5k views
4 votes
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.

AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."

User Sathish Kumar K K
by
5.0k points

2 Answers

4 votes
I agree I think it is C
User JiangHongTiao
by
4.8k points
7 votes

Answer:

C.) Separate the list into three-letter

Step-by-step explanation:

User Jeremy Kie
by
5.4k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.6m questions

7.3m answers

Other Questions

Which of these structures is primarily responsible for the enzymatic breakdown of a large molecules in the cell?
What are some common signs and symptoms of mental health disorders?
A state of joyful activity in which the subject performs an action effortlessly and skillfully is known as a(n) __________.
!! Earth Science!! Carbon dioxide is normally approximately 2% fraction of the air in the atmosphere. The reason carbon dioxide is considered a pollutant is because... a) Carbon dioxide levels are much
Which statement best describes the life cycle of plants such as ferns? a. Different plants have a different number of phases in their life cycle. b. Plants have a single life cycle and are entirely haploid.
Link Copied!